Collectively, we demonstrated that Kindlin-2 in Sertoli cells is essential for sperm development and male reproduction. mice to generate mice (Supplementary Fig. YAP phosphorylation and decreases its nuclear translocation. For clinical relevance, lower Kindlin-2 expression and decreased nucleus localization of YAP was found in SCOS patients. Collectively, we demonstrated that Kindlin-2 in Sertoli cells is essential for sperm development and male reproduction. mice to generate mice (Supplementary Fig. 1C)16. Fluorescence microscopy showed that tdTomato was expressed in the whole testes (i.e., all testicular cells of the testes) of mice, while eGFP was expressed specifically in Amh promoter-containing cells of testis with the stromal cells of negative cells remaining red, indicating the specificity of knockout (Supplementary Fig. 1D). From general observation, there were no significant differences between the (KO) mice and mice with control genotypes at A 967079 8 weeks (8?W), i.e., mice (Supplementary Fig. 1E). Therefore, we used (WT) mice as controls in the subsequent experiments. However, KO mice showed A 967079 much smaller testicles than control mice (8?W) (Supplementary Fig. 1F). The male KO mice also showed smaller epididymis compared to control mice (8?W) (Supplementary Fig. 1G). After birth, the testicular volume of KO mice was found to remain low at indicated time, and the testes of KO mice did not develop during 2C6?W (Fig. 1A, B). Testicular underdevelopment was observed in all KO mice (100%) but none (0%) of the mice in the control group. Histological examination revealed that with specific Kindlin-2 KO in A 967079 SCs, the seminiferous tubules collapsed at 4?W (blank broken lines) (Fig. ?(Fig.1C).1C). However, the sizes of the testicles and epididymis of 2-day-old KO mice were not significantly different from controls (Supplementary Fig. 2A). In addition, the testicular cords of 2-day-old KO mice appeared grossly normal compared with the control group (Supplementary Fig. 2A). Open in a separate window Fig. 1 Sertoli cell-specific knockout of Kindlin-2 in mice induced destruction of seminiferous tubules and testicular dysplasia.A Gross morphology of testes from WT (refers to and the junction protein were also significantly decreased in Kindlin-2-depleted SCs. Remarkably, the expression of and and mice and Amh-Cre mice were crossed to obtain as experimental group. The floxed (mice crossed with Amh-Cre mice to generate mice, Then the mice were intercrossed to generate mice which referred to as KO mice. For all animal studies transgenic mice were backcrossed eight times to C57BL/6. After the animal has been A 967079 identified, animal observation of each genotype is randomized. Genotyping Primers used in PCR A 967079 genotyping of WT or KO mice were as follows, genotypes were determined by multiplex polymerase chain reaction (PCR) using DNA prepared from mouse tail samples. forward primer (5 to 3): tacaggtggctgacaagatcc; reverse primer (5 to 3): gtgaggctcacctttcagagg; forward primer (5 to 3): tccaatttactgaccgtacaccaa; reverse primer (5 to 3): cctgtacctggcaatttcggcta. Primers for genotyping the and mice were detected using primers LoxP-F and LoxP-R with a 743 and 839?bp PCR product, respectively. The reaction conditions were: 94?C for 5?min; 35 cycles of 94?C for 30?s; 57.5?C for 30?s; 72?C for 30?s; final extension step of 72?C for 5?min. PCR genotyping of Cre mice using primers Cre-F and Cre-R with following conditions: 94?C for 5?min; 35 cycles of 94?C for 30?s; 61.5?C for 30?s; 72?C for 30?s. Histological immunostaining The testes or epididymis tissues were fixed in Bouins solution for hematoxylin and eosin (HE) staining or in 4% formaldehyde (PFA) in PBS for immunostaining. In brief, tissues were fixed overnight, embedded in paraffin wax, and cut to produce 5 m-thick sections. For immunohistochemistry (IHC), the sections were dewaxed in xylene and rehydrated in serial dilutions of alcohol. Endogenous peroxidase was blocked by immersing the sections in 0.3% H2O2 in methanol for 20?min at room temperature. The sections were then blocked with 5% bovine serum albumin (BSA) and incubated with the primary antibody at 4?C overnight, and then the secondary antibody was applied for 1?h. Staining was visualized using a DAB substrate kit according to the manufacturers protocol (Zhongshan Technology, Beijing, China). The negative controls were subjected Rabbit Polyclonal to SMUG1 to the same protocol except that PBS was used instead of the primary antibody. We use double blind strategy in tissue analysis experiment. Immunofluorescence and confocal analysis Cells were seeded and cultured on sterile glass cover slips in six-well plates. 24?h later, cells were fixed in 10 %10 %.