Supplementary Materialscells-09-01635-s001. not faithfully reflect the normal physiological functions of the WRC complex. In vivo functional studies using the mouse model are hampered by prenatal lethality phenotypes of WRC complex members. Therefore, we established an inducible floxed mouse model to robustly isolate MEF for WRC functional studies. NCKAP1 belongs to the HEM family of proteins, originally thought to be transmembrane proteins, but now known to be cytoplasmic and is conserved as a subunit of the WRC in a wide range of organisms. It has been implicated in a wide range of cytoskeletal functions, including embryonic development [14], axonal growth [15], differentiation of neurons [16], and chemotaxis [17]. Here we show that cells lacking NCKAP1 change from lamellipodia-based to pseudopodia-like migration that has altered focal adhesion dynamics and reduced migration velocity/distance that can be partially rescued by plating on collagen. 2. Materials and Methods 2.1. Transgenic Mice and Isolation of Nckap1fl/fl Mouse Embryonic Fibroblasts All animal experiments were performed according to the UK Home Office regulations JAK1-IN-4 and in compliance with EU Directive 2010/63 and the UK Animals (Scientific Procedures) Act 1986. JAK1-IN-4 All protocols and experiments were previously approved by the Animal Welfare and Ethical Review Body (AWERB) of the University of Glasgow and were accompanied by a UK Home Office project license (7008123July 2014; PE494BE48April 2019). The floxed mouse strain was created using a targeting vector (PG00182_Z_4_C05) obtained from the consortium for The European Conditional Mouse Mutagenesis Program (EUCOMM) and described [18]. ES cells transfections, JAK1-IN-4 clone selection, and injection into C57BL/6J blastocysts were performed according to standard protocols outlined in [19,20]. mice were bred with [21] and knockout in B16-F1 mouse melanoma cells was essentially carried out as described in [24,25]. In contrast to KO clones (#6 JAK1-IN-4 and #21) used in Dolati et al., which still formed low numbers of aberrant lamellipodia due to compensatory expression of the hematopoietic counterpart KO clone #16 that was virtually devoid of lamellipodia was used in this study. 2.3. Mammalian Cell Culture Conditions Mouse embryonic fibroblasts and mouse melanoma B16-F1 cells were maintained in Dulbeccos Modified Eagles Medium (DMEM) supplemented with 10% FBS, 2 mM l-glutamine. Mouse embryonic fibroblasts were maintained in complete DMEM supplemented with 1 mgmL?1 primocin. 2.4. Transfection of Mammalian Cells Lines mouse embryonic fibroblasts were transiently transfected by electroporation (Amaxa, Kit T, program T-020) with 5 g DNA and plated overnight to recover. B16-F1 cells were plated on a 6-well plate and grown to 70% confluency and later transfected with Lipofectamine 2000 following the manufacturers guidelines with 2C5 g DNA. 2.5. Genetic Knockouts Inducible knockout MEFs were generated by the addition of 1 M 4-hydroxytamoxifen (OHT) in the growth medium being replaced every 3 days over a 7-day period. 2.6. Analytical PCR gDNA was isolated from DMSO or OHT treated MEFs using a Qiagen DNeasy Blood and Tissue kit following the manufacturers protocol. PCR was performed to determine the efficiency of recombination by the loss of the N-terminal region of using specifically designed primers (#fw: CTCTCTTGTCTACTGTGCAGG and #rv: CTCGTAGACCAAACTAGCCTCAAG). 2.7. Cell Proliferation and Viability Cells were harvested and adjusted to 1 1 104 cells, which were plated onto 6-well plates. Each subsequent day the cells were harvested and counted using a hemocyotometer for cells per well to determine the proliferation rates of the cell lines. Data are presented from 3 technical replicates, repeated three times independently. On days 3, 5, and Ly6a 7 after plating, harvested cells were also tested for their viability using Trypan Blue solution. A 1:1 cell suspension of cells and 0.4% Trypan Blue was mixed and added to the hemocytometer and left for 2 min prior to counting. Viable cells do not take up JAK1-IN-4 the dye, while.